Watson and Crick observed that the two strands of DNA are anti-parallel and complementary to each other with respect to their base sequences. This type of arrangement in DNA molecule led to the hypothesis that DNA replication is semiconservative. It means that the double stranded DNA molecule separaRead more
Watson and Crick observed that the two strands of DNA are anti-parallel and complementary to each other with respect to their base sequences. This type of arrangement in DNA molecule led to the hypothesis that DNA replication is semiconservative. It means that the double stranded DNA molecule separates and then, each of the separated strand acts as a template for the synthesis of a new complementary strand. As a result, each DNA molecule would have one parental strand and a newly synthesized daughter strand.
Since only one parental strand is conserved in each daughter molecule, it is known as semi-conservative mode of replication.
If the coding strand in a transcription unit is 5’− ATGCATGCATGCATGCATGCATGCATGC-3’ Then, the template strand in 3’ to 5’ direction would be 3’ − TACGTACGTACGTACGTACGTACGTACG-5’ It is known that the sequence of mRNA is same as the coding strand of DNA. However, in RNA, thymine is replaced by uracil.Read more
If the coding strand in a transcription unit is
5’− ATGCATGCATGCATGCATGCATGCATGC-3’
Then, the template strand in 3’ to 5’ direction would be
3’ − TACGTACGTACGTACGTACGTACGTACG-5’
It is known that the sequence of mRNA is same as the coding strand of DNA.
However, in RNA, thymine is replaced by uracil.
Hence, the sequence of mRNA will be
5’ − AUGCAUGCAUGCAUGCAUGCAUGCAUGC-3’
The DNA strands are complementary to each other with respect to base sequence. Hence, if the sequence of one strand of DNA is 5'- ATGCATGCATGCATGCATGCATGCATGC − 3’ Then, the sequence of complementary strand in 5' to 3' direction will be 3'- TACGTACGTACGTACGTACGTACGTACG − 5’ Therefore, the sequence oRead more
The DNA strands are complementary to each other with respect to base sequence. Hence, if the sequence of one strand of DNA is
5′- ATGCATGCATGCATGCATGCATGCATGC − 3’
Then, the sequence of complementary strand in 5′ to 3′ direction will be
3′- TACGTACGTACGTACGTACGTACGTACG − 5’
Therefore, the sequence of nucleotides on DNA polypeptide in 5′ to 3′ direction is
5′- GCATGCATGCATGCATGCATGCATGCAT− 3’
According to Chargaff’s rule, the DNA molecule should have an equal ratio of pyrimidine (cytosine and thymine) and purine (adenine and guanine). It means that the number of adenine molecules is equal to thymine molecules and the number of guanine molecules is equal to cytosine molecules. % A = % T aRead more
According to Chargaff’s rule, the DNA molecule should have an equal ratio of pyrimidine (cytosine and thymine) and purine (adenine and guanine). It means that the number of adenine molecules is equal to thymine molecules and the number of guanine molecules is equal to cytosine molecules.
% A = % T and % G = % C
If DNA has 20% of cytosine, then according to the law, it would have 20% of guanine.
Thus, percentage of G + C content = 40%
The remaining 60% represents both A + T molecule.
Since adenine and guanine are always present in equal numbers, the percentage of adenine molecule is 30%.
Nitrogenous bases present in the list are adenine, thymine, uracil, and cytosine. Nucleosides present in the list are cytidine and guanosine. For more answers visit to website: https://www.tiwariacademy.com/ncert-solutions/class-12/biology/chapter-6/
Nitrogenous bases present in the list are adenine, thymine, uracil, and cytosine.
Nucleosides present in the list are cytidine and guanosine.
Which property of DNA double helix led Watson and Crick to hypothesise semiconservative mode of DNA replication? Explain.
Watson and Crick observed that the two strands of DNA are anti-parallel and complementary to each other with respect to their base sequences. This type of arrangement in DNA molecule led to the hypothesis that DNA replication is semiconservative. It means that the double stranded DNA molecule separaRead more
Watson and Crick observed that the two strands of DNA are anti-parallel and complementary to each other with respect to their base sequences. This type of arrangement in DNA molecule led to the hypothesis that DNA replication is semiconservative. It means that the double stranded DNA molecule separates and then, each of the separated strand acts as a template for the synthesis of a new complementary strand. As a result, each DNA molecule would have one parental strand and a newly synthesized daughter strand.
Since only one parental strand is conserved in each daughter molecule, it is known as semi-conservative mode of replication.
For more answers visit to website:
See lesshttps://www.tiwariacademy.com/ncert-solutions/class-12/biology/chapter-6/
If the sequence of the coding strand in a transcription unit is written as follows: 5′-ATGCATGCATGCATGCATGCATGCATGC-3′. Write down the sequence of mRNA.
If the coding strand in a transcription unit is 5’− ATGCATGCATGCATGCATGCATGCATGC-3’ Then, the template strand in 3’ to 5’ direction would be 3’ − TACGTACGTACGTACGTACGTACGTACG-5’ It is known that the sequence of mRNA is same as the coding strand of DNA. However, in RNA, thymine is replaced by uracil.Read more
If the coding strand in a transcription unit is
5’− ATGCATGCATGCATGCATGCATGCATGC-3’
Then, the template strand in 3’ to 5’ direction would be
3’ − TACGTACGTACGTACGTACGTACGTACG-5’
It is known that the sequence of mRNA is same as the coding strand of DNA.
However, in RNA, thymine is replaced by uracil.
Hence, the sequence of mRNA will be
5’ − AUGCAUGCAUGCAUGCAUGCAUGCAUGC-3’
For more answers visit to website:
See lesshttps://www.tiwariacademy.com/ncert-solutions/class-12/biology/chapter-6/
If the sequence of one strand of DNA is written as follows: 5′-ATGCATGCATGCATGCATGCATGCATGC-3′ Write down the sequence of complementary strand in 5’→3′ direction
The DNA strands are complementary to each other with respect to base sequence. Hence, if the sequence of one strand of DNA is 5'- ATGCATGCATGCATGCATGCATGCATGC − 3’ Then, the sequence of complementary strand in 5' to 3' direction will be 3'- TACGTACGTACGTACGTACGTACGTACG − 5’ Therefore, the sequence oRead more
The DNA strands are complementary to each other with respect to base sequence. Hence, if the sequence of one strand of DNA is
5′- ATGCATGCATGCATGCATGCATGCATGC − 3’
Then, the sequence of complementary strand in 5′ to 3′ direction will be
3′- TACGTACGTACGTACGTACGTACGTACG − 5’
Therefore, the sequence of nucleotides on DNA polypeptide in 5′ to 3′ direction is
5′- GCATGCATGCATGCATGCATGCATGCAT− 3’
For more answers visit to website:
See lesshttps://www.tiwariacademy.com/ncert-solutions/class-12/biology/chapter-6/
If a double stranded DNA has 20 per cent of cytosine, calculate the per cent of adenine in the DNA.
According to Chargaff’s rule, the DNA molecule should have an equal ratio of pyrimidine (cytosine and thymine) and purine (adenine and guanine). It means that the number of adenine molecules is equal to thymine molecules and the number of guanine molecules is equal to cytosine molecules. % A = % T aRead more
According to Chargaff’s rule, the DNA molecule should have an equal ratio of pyrimidine (cytosine and thymine) and purine (adenine and guanine). It means that the number of adenine molecules is equal to thymine molecules and the number of guanine molecules is equal to cytosine molecules.
See less% A = % T and % G = % C
If DNA has 20% of cytosine, then according to the law, it would have 20% of guanine.
Thus, percentage of G + C content = 40%
The remaining 60% represents both A + T molecule.
Since adenine and guanine are always present in equal numbers, the percentage of adenine molecule is 30%.
Group the following as nitrogenous bases and nucleosides: Adenine, Cytidine, Thymine, Guanosine, Uracil and Cytosine.
Nitrogenous bases present in the list are adenine, thymine, uracil, and cytosine. Nucleosides present in the list are cytidine and guanosine. For more answers visit to website: https://www.tiwariacademy.com/ncert-solutions/class-12/biology/chapter-6/
Nitrogenous bases present in the list are adenine, thymine, uracil, and cytosine.
Nucleosides present in the list are cytidine and guanosine.
For more answers visit to website:
See lesshttps://www.tiwariacademy.com/ncert-solutions/class-12/biology/chapter-6/